snOPY snoRNA Orthological Gene Database
Rattus_norvegicus SNORA67
sequence
GTCCAAGGTGATTCCCTCTCCAAAGGACTGACTGTGTGCCCTTCTCAGGGACGTAGCAA
CTTGGAAGAAAGCCATGCATGCCCAAGGTCTCTGGTGGACAAGGAATACCTGTTTCCTTT
GCCTTCCTTTGGCTGCCTACATAT
  Box motif
  Complementary to target RNA
length 143
organism Rattus_norvegicus
snoRNA name SNORA67
alias
chromosome ⁄ contig 12
locus ⁄ host gene Mono:518:SNORA67
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved