snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus SNORA42
sequence
GCATGGGTTTGGATTTATGATGGGCCCGTCCCCCCGGACCTCTCATAGTACCCCATGCC
AGAGCAAACTGTAGCCCTGAACCATTGCCTGGCCTCTGTGCCCGTAGGCTGCTGGCACTG
AAGTGGGTTGCACAATA
  Box motif
  Complementary to target RNA
length 136
organism Pongo_pygmaeus
snoRNA name SNORA42
alias
chromosome ⁄ contig 21
locus ⁄ host gene ENSPPYG00000011359
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved