snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus SNORA36
sequence
CAATGCCTTGAGTTCAGTCGAGGACAGCTTCCCTTTTCTGTTAATTAAACTTTGGAACA
TTGGGGCATTAAAACAGGCTAGGGTAGGTGATTGCACAGAGAATATTATTCTATTCATTT
CCTTCCTAGCCAAAAACA
  Box motif
  Complementary to target RNA
length 137
organism Pongo_pygmaeus
snoRNA name SNORA36
alias
chromosome ⁄ contig 5
locus ⁄ host gene FGF1_PONPY
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved