snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus SNORD63
sequence
GTGCAATGATGTATTTTATTCAACACATCATTCTGAAAGAACGTGTGGAAAACTAATGA
CTGAGCACA
  Box motif
  Complementary to target RNA
length 68
organism Pongo_pygmaeus
snoRNA name SNORD63
alias
chromosome ⁄ contig 5
locus ⁄ host gene Q5R511_PONPY
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved