snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus SNORA70
sequence
CTGCAGTCAATTAAGTGTACTGATTTCCTTTCCTTATGGGGGCCCAGTGTGCAATGGCT
GCAAACAGCAGCTTCCTTGGTGGTGTATGCAGCCTGTTTCCTGTATAGGTTGCTCTAAGG
GACCTTGATAGTAGGC
  Box motif
  Complementary to target RNA
length 135
organism Pongo_pygmaeus
snoRNA name SNORA70
alias
chromosome ⁄ contig 2b
locus ⁄ host gene Q5REY1_PONPY
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved