snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus SNORD41
sequence
TGGGAAGTGATGACACCTGTGACTGTTGATGTGGAACTGATTTATCTTGTATTCGTACT
GGCTGATCCTG
  Box motif
  Complementary to target RNA
length 70
organism Pongo_pygmaeus
snoRNA name SNORD41
alias
chromosome ⁄ contig 19
locus ⁄ host gene TNPO2
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved