snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus SNORA53
sequence
AACATGCTTCCTTAGATCCACCTTTGTGGATGAATCTTGAACTGAGTTCCACTTGTAAA
CTTCTTGTTTCTTGTGGTTCCAGTCAAAGAAACATCCAGCAACTTTTTTGGTTGTATAGT
CAAAGGTGCATGAGTCATTGGCATGTAAGAGAAATATACCTGCATGTTAGTCTAACGTTC
TGATAGAAATGACATGCATTTATGCTGCCCATTTGTTACTATCAGGACTCGACTCGTGTG
CGGGACAT
  Box motif
  Complementary to target RNA
length 247
organism Pongo_pygmaeus
snoRNA name SNORA53
alias
chromosome ⁄ contig 12
locus ⁄ host gene MPCP_PONPY
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved