snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus SNORD59
sequence
CCTCACTGATGAGTAACGTTTTCTGACTTTTCGTTCTTCTTGAGTTTGGCTGAAGCCAG
ATGCAATTTTCTGAGAAAG
  Box motif
  Complementary to target RNA
length 78
organism Pongo_pygmaeus
snoRNA name SNORD59
alias
chromosome ⁄ contig 12
locus ⁄ host gene ATP5B
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved