snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus SNORA51
sequence
GGCCTCCTGGTGCTTACCACAGGCTGTGTTCTTACACTGACTGTATAGAAAGAGGAGGT
AGAGTAAACCTACCCCATATACACCTCAGCTCAGGCCCTGTGCCTGGTCTGTATTGTGAA
TGGGGGAACACAG
  Box motif
  Complementary to target RNA
length 132
organism Pongo_pygmaeus
snoRNA name SNORA51
alias
chromosome ⁄ contig 20
locus ⁄ host gene NOL5A_PONPY
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved