snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus SNORA14
sequence
CTGCATTCTTAAACCCTCTTGGTAGCTTCGTTCTAAGTGCTTCCAAGATATGAGTGAAT
GCTATAGAAATTGCAGGGGAGTCCAAAGGGCTGCGCTTCTCCCGTGGCTGAGTCTTATTT
CATACCTGCGACATCT
  Box motif
  Complementary to target RNA
length 135
organism Pongo_pygmaeus
snoRNA name SNORA14
alias
chromosome ⁄ contig 1
locus ⁄ host gene TOM20_PONPY
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved