snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus SNORA42
sequence
GCATGGGTTTGGATTTATGACAGGCCCATCCCCCGGACCTCTCATAGTGCCCCATGCCA
GAGCAAACTGGCCCCGAACCATTGCCTGGCTTCTGTTCCCGTGGGCCACTGGCACTGAAG
AGGGTTACACAGTG
  Box motif
  Complementary to target RNA
length 133
organism Pongo_pygmaeus
snoRNA name SNORA42
alias
chromosome ⁄ contig 7
locus ⁄ host gene JTV1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved