snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus SNORA35
sequence
CAGCACTGCCGAGTGACCCATTGGGCTCCACCTTGACCAACTGGGCATCAAGCGGTGCA
AAAGCAAATCCCTCTCAAAGCTGGGAGAGTCACACCGTGGGCTACTCCTGCATGCAGCTG
GGTACATAT
  Box motif
  Complementary to target RNA
length 128
organism Pongo_pygmaeus
snoRNA name SNORA35
alias
chromosome ⁄ contig X
locus ⁄ host gene Mono:62:SNORA35
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved