snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus SNORD115
sequence
GGGTCGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATTC
TCAAAAGGATTATTCTGAGGCCT
  Box motif
  Complementary to target RNA
length 82
organism Pongo_pygmaeus
snoRNA name SNORD115
alias
chromosome ⁄ contig 15
locus ⁄ host gene
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved