snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus SNORA7
sequence
AATCTCCTGGGATTGTGTCTGGAGAGTGCCCAGTATTCTGCCACCTTCAGAAGGAAGGG
AAAGCAAACCTTCATGAAAGCAGAGGCATTCATTCCATTCCCAGCTTGCTCCAGATCTGG
CAATTGGAAGACATTCTGCAACAGTG
  Box motif
  Complementary to target RNA
length 145
organism Pongo_pygmaeus
snoRNA name SNORA7
alias
chromosome ⁄ contig 8
locus ⁄ host gene Poly:17:SNORA7
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved