snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus SNORD45
sequence
GGTCAATGATGTAATGGCATGTATTAGCTGAATCCAAAGTTGATGTGAATTCTAAAATT
ACACCAAGACCTT
  Box motif
  Complementary to target RNA
length 72
organism Pongo_pygmaeus
snoRNA name SNORD45
alias
chromosome ⁄ contig X
locus ⁄ host gene Mono:57:SNORD45
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved