snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus SNORA64
sequence
GGCCTCTCAGCCTCGCTTAATCACACAGGTCCATTGTGTGCTTGGTGTGTTTTCTGGGA
GGCAGAGGAAGGCTCTCCTAATCACAACAGACCTGCCCAGAATGGCCTCTCCATTTCTAG
GAGTATGATAGCT
  Box motif
  Complementary to target RNA
length 132
organism Pongo_pygmaeus
snoRNA name SNORA64
alias
chromosome ⁄ contig 12
locus ⁄ host gene Mono:79:SNORA64
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved