snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus SNORA40
sequence
TAAACGTTGAGGTCTTGTGGACAAAGACTTATGGACAGGTGCAAACCACAAATCCTCTT
TTGCAACCCAGAACTTATTGTTCAGTATGAGTTTTGATACATGTAAGAAGGGATATT
  Box motif
  Complementary to target RNA
length 116
organism Pongo_pygmaeus
snoRNA name SNORA40
alias
chromosome ⁄ contig 5
locus ⁄ host gene Mono:283:SNORA40
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved