snOPY snoRNA Orthological Gene Database
Pan_troglodytes SNORA11
sequence
GGGGTGCACTCAGGGCAGGGGGCTTGAAGAACGGCTCCTCTGTTTACGACACACTCAAC
AGGGGTCTGAGGTCACAGTGATGAGAGGCCCAAACTTGTGGCCTCCCCGTGAACAAATGC
CCTACACAT
  Box motif
  Complementary to target RNA
length 128
organism Pan_troglodytes
snoRNA name SNORA11
alias
chromosome ⁄ contig 21
locus ⁄ host gene KCNE1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved