snOPY snoRNA Orthological Gene Database
Pan_troglodytes SNORA46
sequence
AGCACTATATTTAAACCTGTGGATGGGAATATTCCCCATTCTTGGTTACGCTGTAGTGC
AAAAGAATTCCTGGCTCTCTGTTGCACAGCTGACTTGTGCCATTCTGCTGTTGCTGTATA
GAGTTAAGGAACATGG
  Box motif
  Complementary to target RNA
length 135
organism Pan_troglodytes
snoRNA name SNORA46
alias
chromosome ⁄ contig 16
locus ⁄ host gene CNOT1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved