snOPY snoRNA Orthological Gene Database
Pan_troglodytes SCARNA9
sequence
tttctgagatctgcttttagtgaagtggatcaatgatgaaactagccaaatctgagcat
cagaagtctttccagtctacctgatgcatgatctctacagttctgagaagcaaaactata
aaacaatgtaaaacaataagggcatatgtctggtgtgtgtgtgtgtgtgtgtgtgtgtgt
gtgtgtgtgtgtgtgtacgcacatgtgtttataaagataacagctgtaggaatgaatgag
attgagggtgggggggtgcgtatgtatgtctatgaaagcctaatcatttctgggcaatga
tgaaaaggttttactactgatctttgtaactatgatggtttctacacttgacctgagctc
a
  Box motif
  Complementary to target RNA
length 360
organism Pan_troglodytes
snoRNA name SCARNA9
alias snoU2-30
chromosome ⁄ contig 11
locus ⁄ host gene ENSPTRG00000004175
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved