snOPY snoRNA Orthological Gene Database
Pan_troglodytes SNORA64
sequence
AGACTCCCAGCTCTGCCCAGTTACACTAGGCTTCGCCTGTGTGGCTTTTGTAATGGGGA
GGGAGAGAAAGGATCTCCCCAGGACCTCAGATTGGCTTTACTGTGGCATCTCTTTCCTTG
AGGGACACAACAGGT
  Box motif
  Complementary to target RNA
length 134
organism Pan_troglodytes
snoRNA name SNORA64
alias
chromosome ⁄ contig 3
locus ⁄ host gene MYRIP
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved