snOPY snoRNA Orthological Gene Database
Pan_troglodytes SNORA51
sequence
GCCCTCCTAGTGCTTACCACAGGCTGTGTTCTTACACTGACTGTATAGAAAGAGAAGGT
AGAATAAACCTACCCCATATGCACTTCAGCCCAACTGAAGTGTGTTGTTCCTGGGCCAAA
AAGA
  Box motif
  Complementary to target RNA
length 123
organism Pan_troglodytes
snoRNA name SNORA51
alias
chromosome ⁄ contig 4
locus ⁄ host gene WDR17
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved