snOPY snoRNA Orthological Gene Database
Pan_troglodytes SNORD73
sequence
AATGAATGATGACAAAATGTTTCAGTCCCAAATGATACATACTGATTATACCGTTAATA
CCGTTATATTTATCCTGACATT
  Box motif
  Complementary to target RNA
length 81
organism Pan_troglodytes
snoRNA name SNORD73
alias
chromosome ⁄ contig 4
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved