snOPY snoRNA Orthological Gene Database
Pan_troglodytes SNORA70
sequence
CTGCAGCTAGTTAACCACCTCCCTGCTGGGGGCTCAGTGTGCAATGGTTGCAAAATGGA
GATTCCCTGGTTGTGTATACACCTCATTTCTTGAATGTGTTGCTTTAAGGGTTCTTGAAG
ACATTA
  Box motif
  Complementary to target RNA
length 125
organism Pan_troglodytes
snoRNA name SNORA70
alias
chromosome ⁄ contig 14
locus ⁄ host gene XR_019704.1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved