snOPY snoRNA Orthological Gene Database
Pan_troglodytes SNORA62
sequence
AAGGCAGCATTGTTGTAGATGATTTGAAAGATTTTAAAAGGTATAAGCTCACAAGTGTA
GGTAGTGTGCAACATGAGGGGCAAGTTTTTCACTAATATTACAAGGGTCTCTGATCCAGT
GAATGGAGTTTGATAGTAATTTTTGATACAAGT
  Box motif
  Complementary to target RNA
length 152
organism Pan_troglodytes
snoRNA name SNORA62
alias
chromosome ⁄ contig 1
locus ⁄ host gene ZMYM4
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved