snOPY snoRNA Orthological Gene Database
Pan_troglodytes SCARNA9
sequence
TCTCTGAGATCTGCTTTTACTGAAGTGGATCAATGATGAAACTAGCCAAATCTGAGCAT
CAGAAGGCTTTCCAGTCTACCTGATGCATGATCTCTACAGTTCTGAGAAGCAAAACTATA
AAACAATGTAAAACAATAAGGGCATATATCTGGTGTGTGTGTGTGGGGGGGTGTGTGTGT
GTGCACCCACACGTGTTTATAAAGGTAGCAGTTGTAGGAATGAATGAGATTGGGGGTGAG
GGGGTGCGTATGTATGTCTATGAAAGCCTAATCATTTCTGGGCAATGATGTAAAGGTTTT
ACGACTGACCTTTGTAACTATGAAGGTTTCTACACTTGACCTGAGCTCA
  Box motif
  Complementary to target RNA
length 348
organism Pan_troglodytes
snoRNA name SCARNA9
alias
chromosome ⁄ contig X
locus ⁄ host gene EIF1AX
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved