snOPY snoRNA Orthological Gene Database
Pan_troglodytes SNORD22
sequence
TCCCAATGAAGAAACTTTCACATGTCTTACTCTCTGTCCTAGTCCCAGAGCCTGTAAAG
GTGAACCCACTGGGACTGGCTGGGGGAGAAGAGGAAGATTTGTTCCAGAAGGAACTGTCT
GAGGGAT
  Box motif
  Complementary to target RNA
length 126
organism Pan_troglodytes
snoRNA name SNORD22
alias
chromosome ⁄ contig 11
locus ⁄ host gene
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved