snOPY snoRNA Orthological Gene Database
Pan_troglodytes SNORD81
sequence
GAAAATACATGATGATCTCACTCCAACTGGAACTCTCTCACTGATTACTTGATAACACT
AAAATATCTGATATTCTG
  Box motif
  Complementary to target RNA
length 77
organism Pan_troglodytes
snoRNA name SNORD81
alias
chromosome ⁄ contig 1
locus ⁄ host gene
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved