snOPY snoRNA Orthological Gene Database
Pan_troglodytes SNORA63
sequence
AAAAAAAAAAAAAGATAAATAAAATAAAATAAAGTTGTTTCTTAACTATACCTGTCTGC
TATTCTCCTGTAGCAACCAGGGATGATTGGTTTCATACAT
  Box motif
  Complementary to target RNA
length 99
organism Pan_troglodytes
snoRNA name SNORA63
alias
chromosome ⁄ contig 7
locus ⁄ host gene Mono:80:SNORA63
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved