snOPY snoRNA Orthological Gene Database
Pan_troglodytes SNORA20
sequence
CTTCCCGTTTATTTGCTGGTATAATCATACAATGATATGAGCAGTTATACTCTTTGGAA
AAAATAATATTGGGCCATTGTAAATTGATATGAAGTAAGTATTTTCATATCTTCTGTAAT
GGACTAGATGTTG
  Box motif
  Complementary to target RNA
length 132
organism Pan_troglodytes
snoRNA name SNORA20
alias
chromosome ⁄ contig Y
locus ⁄ host gene Mono:315:SNORA20
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved