snOPY snoRNA Orthological Gene Database
Pan_troglodytes SNORD115
sequence
GGGTCAATGACGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGC
TCAATAGGATTACGCTGAGGCCC
  Box motif
  Complementary to target RNA
length 82
organism Pan_troglodytes
snoRNA name SNORD115
alias
chromosome ⁄ contig 15_random
locus ⁄ host gene Poly:3:SNORD115
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved