snOPY snoRNA Orthological Gene Database
Pan_troglodytes SNORA43
sequence
GCTGTCCTGGACCTGTTGGCACCACAGACAGTTGCTCTGCTGTGCCTGTGGCCTCGGGG
CAAAGAGAAAGTGGCGATTTCTACACTCAGTGCTCGGGAACCAGTGGGCACTGAGAATGG
TTTATGGCCTGACATTA
  Box motif
  Complementary to target RNA
length 136
organism Pan_troglodytes
snoRNA name SNORA43
alias
chromosome ⁄ contig 9
locus ⁄ host gene Poly:10:SNORA43
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved