snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORA74
sequence
CCCAGCAGTAGTCAGCTGTCCGGACAGAACCATTCCTGTGATGGTGTTACACTGCTGGA
AGAGAAATGTCTTGTCTTCTTTATCCGGTTGCCTCCATCGCTGTTCTGGTGGTGTCTGGC
ACTGATACAAGGCAGAACTGTGCTTCCTTGAGAGTGTGCTAAGCATTCACTTTGACTGCT
TAGTTCTAGTCGGGGAGCAGACACA
  Box motif
  Complementary to target RNA
length 204
organism Otolemur_garnettii
snoRNA name SNORA74
alias
chromosome ⁄ contig GeneScaffold_2472
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved