snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORA17
sequence
ATTGTCCCTAGAGGAGTTGCAGATGTGGCCGTTGTGTCACATTTGTGTCATTAGGTGGC
AGAGAGAAAAAAGGCCATGTATACATTCAGTGTTCTGACCTATGAATGTTTGAATGATTA
ATAGTCTGACACA
  Box motif
  Complementary to target RNA
length 132
organism Otolemur_garnettii
snoRNA name SNORA17
alias
chromosome ⁄ contig GeneScaffold_2201
locus ⁄ host gene ENSOGAG00000002703
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved