snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORD56
sequence
CTGCAATGATGGCAGTATTTTTCAGTCACATCAGTTTACCTAGTGAGTATTGATACTTT
GGGTCTGAAAGA
  Box motif
  Complementary to target RNA
length 71
organism Otolemur_garnettii
snoRNA name SNORD56
alias
chromosome ⁄ contig GeneScaffold_5228
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved