snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORD34
sequence
CGTCCATGATGTTCTACAATTACCTACATTGTTTGAGCTTCGTGAAAACAACACTGGCT
GAGACGC
  Box motif
  Complementary to target RNA
length 66
organism Otolemur_garnettii
snoRNA name SNORD34
alias
chromosome ⁄ contig GeneScaffold_3476
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved