snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORA2
sequence
ATAGCAGTTGCTAAAGAAGATAGTTTTAGATGGCTGGGGAAAATAGATTTTAGTCACTC
TGAGCCTAAAGAATTATCTTTCTATGGTCTGTTGGCCATTTCAGAACTTTGGAAATGTAA
TGGTCAATTCATTAGAAAGAAACAGTA
  Box motif
  Complementary to target RNA
length 146
organism Otolemur_garnettii
snoRNA name SNORA2
alias
chromosome ⁄ contig GeneScaffold_1416
locus ⁄ host gene ADAMTS12
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved