snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORD36
sequence
CTGCAATGATGTACAAATGTCTTCACCTGAAATCACTGTGGAGAGTAAAATCGAGCTTT
TTAACACTGAGTCAC
  Box motif
  Complementary to target RNA
length 74
organism Otolemur_garnettii
snoRNA name SNORD36
alias
chromosome ⁄ contig GeneScaffold_2965
locus ⁄ host gene ENSOGAG00000014027
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved