snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORD74
sequence
GAAATTGGCTTCTAATGTAGCCCATTTTAGTAGGGACATCTGAGAGTAAGGGTGAATGT
CAATGGAGCTGACAAAAAAAT
  Box motif
  Complementary to target RNA
length 80
organism Otolemur_garnettii
snoRNA name SNORD74
alias
chromosome ⁄ contig GeneScaffold_5589
locus ⁄ host gene ENSOGAG00000001736
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved