snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORD31
sequence
GGCACTAGAAGTTTTAAAAATGCTCCTGGTTCCAGTCTGATAACTGTGACTGAAAGGTA
TTTTCTGAACTGAA
  Box motif
  Complementary to target RNA
length 73
organism Otolemur_garnettii
snoRNA name SNORD31
alias
chromosome ⁄ contig GeneScaffold_2627
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved