snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORA33
sequence
AAGCCAGCCAAATAATCTGCTTACCTGAATGTGTTTCTGCAGAAAGTTTTTAAAATCTG
GCAATAGTAAAGCCATGTTACGAGCCTTACGGACATCCAAGTCGTTAAGGTCCCTGAAAA
TGGCTATAACA
  Box motif
  Complementary to target RNA
length 130
organism Otolemur_garnettii
snoRNA name SNORA33
alias
chromosome ⁄ contig scaffold_200
locus ⁄ host gene ENSOGAG00000001309
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved