snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORA33
sequence
AATAGTAATTGTCTTTGGATTAAAAAAATGTGTTTCTGCAGAAATTTTAAAAAAGCTGG
CAATAGCCAGGCCATGTTCTGAGCCTTATGGACACTGAAGTCATTAAGGTCCCTGAAAAT
GGCCTTAACA
  Box motif
  Complementary to target RNA
length 129
organism Otolemur_garnettii
snoRNA name SNORA33
alias
chromosome ⁄ contig scaffold_98797
locus ⁄ host gene Mono:63:SNORA33
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved