snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORA13
sequence
AGCCTTTGTGTTGCCCATTCACTTTGGAAACTAGTGGATGTGGTGTCAAAAAAGGCGTA
CATTAAATGCTTTGCGGCCTTTTCCTGCCCTTAAATCTGGTATTTTTGGTGTAGGAGCTG
CATAAGTAACAGTT
  Box motif
  Complementary to target RNA
length 133
organism Otolemur_garnettii
snoRNA name SNORA13
alias
chromosome ⁄ contig GeneScaffold_4785
locus ⁄ host gene Mono:325:SNORA13
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved