snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORA9
sequence
AATTTGAAAGGAACAATATTTGGGTCTGTGGTGAGCCTGTGCCCTGTGCATTCCTCGAG
TTCCAGCCAGAACAGCTGTGACACTGTTTGAGGCCTTGTCTTGCCCTATCCAGAGCAAGA
TTATAGAAATTTTAGACAGTT
  Box motif
  Complementary to target RNA
length 140
organism Otolemur_garnettii
snoRNA name SNORA9
alias
chromosome ⁄ contig GeneScaffold_352
locus ⁄ host gene Mono:396:SNORA9
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved