snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORA49
sequence
ACTCCTCAGCCTTCCTCAAGGGCTCATGCCTGCTGAGTGCCCTGGCATTGTCTGAGGAT
AGTCCAGCAAGCACCGTCCTCCCCAGTGAGACTCTGCTAACTTTTGGGGCCTGCTAGGTG
AGCTGATGGT
  Box motif
  Complementary to target RNA
length 129
organism Otolemur_garnettii
snoRNA name SNORA49
alias
chromosome ⁄ contig scaffold_106815
locus ⁄ host gene Mono:110:SNORA49
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved