snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORA64
sequence
AAGTTGTCTTAAGAAATTAATGAATTCAAAGGCAAAGTACCAGGGAGAGAAAAGAAGGC
TCTCTTAATGCATGACAGAATTGCCCACAGTGGCCTCTCTGTTCCTGGGAGTGCAACATC
T
  Box motif
  Complementary to target RNA
length 120
organism Otolemur_garnettii
snoRNA name SNORA64
alias
chromosome ⁄ contig scaffold_75170
locus ⁄ host gene Mono:222:SNORA64
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved