snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORA15
sequence
GCATAGCTGAATACTATGTTCTTTTATCAGTAGTTTACATAGCTAGACACCATGCAAAA
ACAGTCTTCCCTTTTAAAATGACTGATAATATGCTAAGTTATTTCATGGTATATCATTAT
TAAAGGTGATAAACGT
  Box motif
  Complementary to target RNA
length 135
organism Otolemur_garnettii
snoRNA name SNORA15
alias
chromosome ⁄ contig scaffold_100460
locus ⁄ host gene Mono:79:SNORA15
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved