snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORD43
sequence
AACAGATGATGAACTCATTGATGGGCAGACATAGGCTGTGCTGATTGTCATGTTCTGTT
GTG
  Box motif
  Complementary to target RNA
length 62
organism Otolemur_garnettii
snoRNA name SNORD43
alias
chromosome ⁄ contig scaffold_83871
locus ⁄ host gene Mono:248:SNORD43
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved