snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORA76
sequence
AAGACTTATTTATACTCTTAAAAATTAGGAAATTGGGGGTCAGGCTGCAGCGCCAGAGC
ACAAGCTTGCGTATAACTGGGGCCGCCGGCCTTCTCCGCGGGCGGCCCTTTTAACCGCAA
GCGACATGG
  Box motif
  Complementary to target RNA
length 128
organism Otolemur_garnettii
snoRNA name SNORA76
alias
chromosome ⁄ contig scaffold_81910
locus ⁄ host gene Mono:237:SNORA76
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved