snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORA49
sequence
ACTCCTCAGCCTTCCTCCAAGGGCTCATGCCTGCTGAGTGCCCTGGCATTGTCTGAGGA
TAGTCCAGCAAGCACCGTCCTCCCCAGTGAGACTCTGCTAACTTTTGGGGCCTGCTAGGT
GAGCTGATGGT
  Box motif
  Complementary to target RNA
length 130
organism Otolemur_garnettii
snoRNA name SNORA49
alias
chromosome ⁄ contig scaffold_106817
locus ⁄ host gene
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved